Stage 2

Developmental timeline and staging designations for Smed embryogenesis. Timeline: days (d) post egg capsule deposition at 20˚C. Gray bars indicate time windows for RNA-Sequencing samples. Double headed arrows: time windows for Stages (S) S1-S8.

 


 

▻ Overview

▻ Stage Description

▻ Images

▻ Download Supplemental Table

▻ In Situ Hybridization Data

▻ Sequences

 

Back to Molecular Staging Resource


 

Overview

 

D2-D3. Sphere formation. A fraction of the blastomeres differentiate into temporary embryonic tissues that provide form and function to the embryo. Undifferentiated blastomeres remain in the embryonic wall. [ PMID:28072387 ]

 

back to top


 

 

Stage Description

 

Embryos undergoing the dynamic process of sphere formation are called protospheres, and appear as loosely adherent masses of shaggy yolk, roughly 200 µm in diameter, in live preparations. During sphere formation some blastomeres differentiate into temporary embryonic tissues, providing form and function to the embryo. The primitive ectoderm forms a single cell layer bounding the sphere. Other blastomeres differentiate into the temporary embryonic pharynx and associated primitive gut cells. The temporary embryonic pharynx is an innervated, muscular pump that ingests yolk into the primitive gut cavity. The primitive gut consists of phagocytic cells associated with the temporary embryonic pharynx. Some undifferentiated blastomeres remain in the embryonic wall, the parenchymal space between the primitive gut and ectoderm.

 

back to top


 

Images

Brightfield images of live Stage 2 (S2) embryos harvested for RNA-Sequencing (left), a paraffin embedded S2 embryo sectioned and stained with hematoxylin and eosin (middle), and heat maps for S2 enriched transcripts (right). Scale bars: 100 µm.

 

Figure 1 – figure supplement 4. Mean centered expression and average RPKM profiles for S2 enriched transcripts. Organized by cluster membership presented shown in the heat map and S2 enriched transcript excel file (Figure 1 – source data 2). S2-S8: Stages 2-8. Y: Yolk.

 

 

 

back to top


 

Download Supplemental Table

 

 

Figure 1 – source data 2. S2 enriched transcripts from pairwise and/or mixed stage reference comparisons
Criteria for flagging differentially expressed transcripts:

1) Pairwise comparison (S2 vs Y): adjusted p-value < 1e-5 S2 vs mixed reference comparison: adjusted p-value <1e-5 2) log2 ratio ≥ 2.322 (5-fold upregulation, both comparisons) or log2 ratio ≤ -2.322 (5 fold downregulation, pairwise comparison only) 3) Average scaled RPKM value ≥ 1.0 for S2 4) Transcript has ≥ 1 ORF 5) Transcripts derived from transposase or retroviruses were omitted, as were S2 enriched transcripts also upregulated in yolk in the mixed reference comparison.

Tabs in this excel file contain 1) pairwise comparison data (if applicable), 2) mixed stage reference comparison data, 3) cluster membership, average RPKM values across embryogenesis (Y-S8), and in C4 and SX adults, as well as best BLASTx hits (E < 0.001) versus the NR, Swiss-Prot, C. elegans, D. melanogaster, D. rerio, X. tropicalis, M. musculus and H. sapiens REF-Seq databases, 4) GO analysis: Manually curated and categorized Biological Process (BP) GO IDs and 5) GO analysis: unabridged results. S2-S8: Stages 2-8. Y: Yolk. C4: C4 asexual adults. SX: Mature sexual adults

 

 

back to top


 

In Situ Hybridization Data

Smed IDGene NameAliasExpression PatternWISH Image
SMED30001362SMEDWI-3piwi-3blastomere
SMED30001900SMED30001900bruli-1blastomere
SMED30003202SMED30003202eIF4a-likeblastomere, primitive ectoderm, temporary embryonic pharynx
SMED30004304SMED30004304PCNAblastomere
SMED30005748HNF4hnf-4temporary embryonic pharynx
SMED30007290GATA456gata456atemporary embryonic pharynx
SMED30007406SMEDWI-1piwi-1blastomere
SMED30010115ribonucleoside diphosphate reductase subunit M2-2RRM2-2blastomere
SMED30013909tud-1tud-1blastomere
SMED30014446SMEDWI-2piwi-2blastomere
SMED30014940SMED30014940gelsolin-likeprimitive ectoderm, temporary embryonic pharynx
SMED30015696SMED30015696MPEG1-like-3primitive gut cell, temporary embryonic pharynx
SMED30018602SMED30018602DDX5-likeblastomere, primitive ectoderm, temporary embryonic pharynx
SMED30023322SMED30023322CTSL-likeprimitive gut cell, temporary embryonic pharynx
SMED30023593SMED30023593netrin-liketemporary embryonic pharynx
SMED30025388SMED30025388Dj-mhctemporary embryonic pharynx
SMED30025427SMED30025427tct-likeblastomere, primitive ectoderm, temporary embryonic pharynx
SMED30027646SMED30027646BTF3-likeblastomere, primitive ectoderm, temporary embryonic pharynx
SMED30032088SMED30032088spondin1-likeblastomere, primitive ectoderm
SMED30035063SOXP-2SOXP-2blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top




Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30007406 ID=SMED30007406|Name=SMED30007406|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30023322 ID=SMED30023322|Name=SMED30023322|organism=Schmidtea mediterranea sexual|type=transcript|length=613bp
ACGCATTCTCTACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACTGGAAATTTGATAAGTTTATCTGAACAACAG
ATTGTTGATTGTGATAGTTTTGATTATGCATGTAACGGTGGATTTGTGACTGATACTTTAACTTATATTAAACAAAATGG
AGGAATTGAATCTGAGCAAGATTATCCATATGTGTCAGGAAGGACGAAGAAACCTAATAAAAAATGTTATTTCAAAAAAG
AAAAAATAGTGGGAACAGATACTGGTTTCGTATCTTTACCTCCAGGAGATGAAGAAGCTCTGAGAGAAGCTCTAGTAACA
ATTGGGCCAATTTCAATAGCTTTTTCCGCGTCGCCTTTGTTATCAGGATATAAGAATGGGATATATCATGATTACATGTG
TGCTGATGTTCGCATCAATCATGCAGTTTTACTAGTAGGATATGGAACGGATGAAGAATCAGGAACACCTTATTGGATAA
TAAAAAACAGTTGGGGTCCCGCATGGGGAGAAAATGGATATTTTCGAATGGAAAGAAATAAAAACATGTGCAACATGGCA
TACAATTCATACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGT
>SMED30032088 ID=SMED30032088|Name=SMED30032088|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
TGAGCAAACCTTTAAG
>SMED30014446 ID=SMED30014446|Name=SMED30014446|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30015696 ID=SMED30015696|Name=SMED30015696|organism=Schmidtea mediterranea sexual|type=transcript|length=2665bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
CTATCACACCAAAAAATCTTCCAGAATTCGATGAACAAGCAGTTTTCAAAATAGCTACGCTCATCAAAGAAGCAGTCAAT
AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
TTGAATAAATGCATAAATTATTGCACCAAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTA
TTGGTGTTCTTCTACAAACAAAACGAAAATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATC
CACTTACAAATTCCTATAGTTGTCCACAATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTC
AATAAGGCAGAGGCTATGGAACACCATTTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGA
TCCTCTCTACAACATTACACAGGATCCCAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTG
TCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCA
CCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGT
TGATGAAAACGGGAAATGGAGTCATAATCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGG
CGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCA
CCGGAATCTCATGAATTTGATAGCAGATATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACC
GTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTT
CAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCC
CGAATTGGGTCACCCTTGTTCACGCAAATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTT
TTCCTTATTTTTATTAGCAATCCGTTTTATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTT
AATGAAACATAGTGAACAATGTGCCACTAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTA
CAGAGTTTAGGTTTGTCATTCATAT
>SMED30018602 ID=SMED30018602|Name=SMED30018602|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30001362 ID=SMED30001362|Name=SMED30001362|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30025388 ID=SMED30025388|Name=SMED30025388|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA
>SMED30025427 ID=SMED30025427|Name=SMED30025427|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC
>SMED30005748 ID=SMED30005748|Name=SMED30005748|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30003202 ID=SMED30003202|Name=SMED30003202|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30010115 ID=SMED30010115|Name=SMED30010115|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30023593 ID=SMED30023593|Name=SMED30023593|organism=Schmidtea mediterranea sexual|type=transcript|length=1962bp
GATCTTGAAATTCTTTTTAAAATTTCTAATCTTATTCATTGGTCTTGTGGCCTTAAATGGAGAACTGCAGACCTGCTACA
GTGCCAATGGAGATCCTAAACCTTGTGAACCATTATTAATAAATTTGGCTCAGCCAATGCATATTGAAGCTAGCTCTACG
TGTGGAGAAAACGGAGCGGAAAGTATTTGTACAGAATGGTTTGACAAACTAGGAAAAGCTCATAAGTCCTGTGAGAAATG
CAATTCTTTAGATCCTAAATTATCAAAATCGTCAAAAATGGTGGTTGATTCACATATACGAGGCAAGGAGACTTGTTGGA
TTTCAGAAGGTGTTCATGAAAGTAGTTATCCAACTAGCGTTAATCTTACATTGGGTTTGAAAAAGAGGTCATTAATATCA
TTTATTACTGTGGAATTATGTGGTCACAACCCGGATGGCATTATTATTTATAAAATGGACAGTGAAACAGATGATTGGTC
TCCTTGGCAATATTTTGCTAAAGACTGTCAACTGACATTTAAGATGCCGGCTTTAACAACGGATACAGTTAATACTTTTT
CCGATATAAATTCATTGAAACCAGTTTGTTTTGATTTGGAAAAAAGTATGGACTATGGAGGAGATGAAAAACTATTCAGA
CTTATCCCATTCAATCCAAGACAAGGCAGAAGTTTTGGAGATGTATTATCTAAAAATGAACAAAACTGGTTGGCAGCTAC
AGAAATACGAATCAGTTATATTCTAACTCCTAAAGAACATTACGGAAATCTGCTGTTGAGAGAAAAGCGAAATGCAGAAA
ATCCTGTTTATCATTTTGGTTCATCTGATATAATGATTGGTGGGCAACCTTTATGTCATGGACATGCTTCGAGAATAATC
AGAACTTCGGATGATACTTATCAGTGTGAATGTCAGCACAGTACTGCTGGAAAGGATTGTGAAAAATGCCATGAAGAATT
CAATGATCAACCGTGGAGTTCAGCAACGATTCGAAACCCAGCGGTTTGTAAAAGATGCGAGTGTAACAATCATTCGATAA
AATGTGTATTCGATTTTAATGTTTTCCTGAAATCTGGTAGAATTCATGGCAGTTCTTGCATAGATTGTGGTGATAACACT
GTCGGCCCTCAGTGTGATCAATGCGCTCCCGGATATTTCCGGCAACATGCTTATCCTATTTACCATAAAAATGCTTGTAA
ACCTTGCTTATGTCATTCAGTTGGATCTCTTTCGGGTACACCCTGCGATCAAGTAAGTGGGAAATGTTTCTGTAAGCCTG
GAGTGACTGGGAAAACATGTACCCATTGTGCACCGGGTTATAAACAAACAAATTCCCTAAAGAATCCTTGCAGAAAGATA
TCAAAATTGCGTCATTTAGTGAAATCAAATTCGAGTTGCGATTTTTGTCAAAGGAAAAGTAAAAGAATTAATTTTAAGAG
ATTTTGCAGCAAGGAAACAAATTTCAAAGTAAATATCAAGAGTAGAGAATCAAGGGGTCAGTGGATTCGGTTCATTTCTG
AAATCGAACAGGTCTGGACAAGAAATCAACAAGATCCCCGAGTATCCCAACTTAATCTAGAATCTAGTGAAGGGACTTCG
ATGTGGGTTCATAAAGATCTCGTGGACTGCGGTTGCGTTGATTTTGAATTCGGTCATTCATATTTAGTCATGGCCAATGT
GAAAACAACGGAATTTATGGGCCAAACTGAACTTATTTTAAACCAAAGTGATGTAATTGAGGATTGGAAGGAGACATGGG
AGGAGCAATTTTCTCAGTTTTATACCCAGGATAAAATGGGAAAATGCAATCGGTTTACTCGACAAAAGCGACACGTCAAG
AGGCGTAATTTTGCCTCAACCTATAACCAATATGCTATCTATTCCTGATCATTTGGACCCGGGATTAATTTAATTAACAT
TTTATCTAGCAGCTGAATGTGATGTCTTATTGTATTTATAAA
>SMED30007290 ID=SMED30007290|Name=SMED30007290|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30014940 ID=SMED30014940|Name=SMED30014940|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30035063 ID=SMED30035063|Name=SMED30035063|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA
>SMED30001900 ID=SMED30001900|Name=SMED30001900|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30013909 ID=SMED30013909|Name=SMED30013909|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30027646 ID=SMED30027646|Name=SMED30027646|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30004304 ID=SMED30004304|Name=SMED30004304|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA

 

back to top